Vaccines

Abstract

The invention provides Streptococcus vaccine strains (e.g. S. equi which is causative of ‘strangles’) comprising the following modifications in their genomes: (i) attenuation of one or more essential biosynthetic genes, (ii) attenuation of one or more genes which encode a haemolytic toxin, or protein involved in the production thereof, plus preferably any one, two, or most preferably three of the following modifications: (iii) attenuation of one or more genes which encode a protein responsible for immune evasion (iv) modification of one or more genes such as to permit serological discrimination of the vaccine strain based on analysis of a protein encoded by said genes, and (v) attenuation of one or more genes which encode an enzyme responsible for recombination repair of the genome. The invention provides inter alia live attenuated vaccine strains which generate an immune response to multiple protective epitopes presented in a context resembling the live pathogen.

Claims

1 - 43 . (canceled) 44 . A Streptococcus vaccine strain comprising a Streptococcus strain with the following modifications in its genome: (i) attenuation of one or more essential biosynthetic genes, (ii) attenuation of one or more genes that encode a hemolytic toxin, or protein involved in the production thereof, plus any one, two, or three of the following modifications: (iii) attenuation of one or more genes that encode a protein responsible for immune evasion (iv) modification of one or more genes to permit serological discrimination of the vaccine strain based on analysis of a protein encoded by the genes, and (v) attenuation of one or more genes that encode an enzyme responsible for recombination repair of the genome. 45 . The strain of claim 44 wherein the attenuation is deletion. 46 . The strain of claim 44 wherein two essential biosynthetic genes are attenuated and wherein the biosynthetic genes are selected from the group consisting of genes in the aromatic or pyramidine or purine pathways. 47 . The strain of claim 46 wherein the biosynthetic genes are aroB and pyrC. 48 . The strain of claim 44 wherein the gene encoding a hemolytic toxin, or protein involved in the production thereof, is the sagA gene. 49 . The strain of claim 44 wherein the protein responsible for immune evasion is one that is responsible for formation of a hyaluronate capsule. 50 . The strain of claim 49 wherein the protein is encoded by the hasA gene. 51 . The strain of claim 44 wherein the protein responsible for immune invasion is a superantigen encoded by a gene selected from the group consisting of seeH, seeI, seeL and seeM. 52 . The strain of claim 44 wherein the protein responsible for immune invasion is a phospholipase encoded by slaA or slaB. 53 . The strain of claim 44 wherein the gene encoding the M protein in the strain or wherein one or more of the superantigen genes, selected from the group consisting of seeH, seeI, seeL and seeM, is modified to permit serological discrimination. 54 . The strain of claim 44 wherein the enzyme responsible for recombination repair of the genome is encoded by the recA gene. 55 . The strain of claim 44 wherein the Streptococcus is a Beta-hemolytic streptococcus shown in Table 7a, Table 7b or Table 8. 56 . The strain of claim 55 wherein the Streptococcus is S. equi. 57 . The strain of claim 44 wherein modifications (i) and (ii) are combined with (iii), (iv) and (v). 58 . The strain of claim 57 , wherein the strain is a SHMAPR strain and wherein the modifications are attenuations in the sagA gene; the hasA gene; the gene encoding the M-protein; the aroB and pyrC genes; and the recA gene 59 . The strain of claim 58 , wherein the strain is a SHMAPR strain comprising further attenuations one, two, three, four, five or six of the following genes: seeH, seeI, seeL, seeM, slaA, and slaB. 60 . The S. equi strain SHMAPR deposited under accession number 13412 with the NCTC. 61 . The deposited strain of claim 60 in a microbiological pure bacterial culture. 62 . A process for producing a Streptococcus vaccine strain comprising (a) making the following modifications to the genome of the strain: (i) attenuation of one or more essential biosynthetic genes, (ii) attenuation of one or more genes encoding a hemolytic toxin or protein involved in the production thereof, plus any one, two or three of the following modifications: (iii) attenuation of one or more genes that encode a protein responsible for immune evasion, (iv) modification of one or more genes to permit serological discrimination of the vaccine strain based on analysis of a protein encoded by the genes, and (v) attenuation of one or more genes that encode an enzyme responsible for recombination repair of the genome, and (b) culturing the resulting strain. 63 . The process of claim 62 , which does not incorporate heterologous plasmid DNA or antibiotic resistance genes into the resulting vaccine strain. 64 . The process of claim 62 wherein the genes are selected from the following genes: (i) the essential biosynthetic genes aroB and pyrC; (ii) the sagA gene encoding the hemolytic toxin or protein involved in the production thereof; (iii) a gene that encodes the protein responsible for immune evasion, selected from the group consisting of hasA, seeH, seeI, seeL, seeM, slaA, and slaB; (iv) a gene that permits serological discrimination of the vaccine strain based on analysis of a protein encoded by the gene, which is selected from the group consisting of the gene encoding the M protein, seeH, seeI, seeL and seeM; and (v) the recA gene, which encodes the enzyme responsible for recombination repair of the genome. 65 . The process of claim 64 wherein the Streptococcus strain is shown in Table 7a, Table 7b or Table 8. 66 . A process for preparing a vaccine, comprising combining the strain of claim 44 with a pharmaceutically acceptable carrier and one or more further additives selected from a) one or more stabilizing proteins to facilitate freeze-drying of the vaccine; b) an adjuvant; and c) a different attenuated pathogen or antigenic material from a different pathogen in order to provide a multivalent vaccine. 67 . The vaccine strain of claim 44 , further comprising a pharmaceutically acceptable carrier. 68 . A method for immunizing a subject against a Streptococcal pathogen, comprising administering to the subject the Streptococcus vaccine strain of claim 67 in an amount sufficient to produce a protective immune response thereto. 69 . The method of claim 68 wherein the streptococcus is S. equi , and the vaccine strain inhibits Streptococcus equi or Streptococcus zooepidemicus infection in horses. 70 . The method of claim 69 wherein the infection is strangles. 71 . The method of claim 70 wherein the strain is administered intramuscularly or intranasally. 72 . The method of claim 71 where the strain is a live strain.
TECHNICAL FIELD [0001] The present invention relates generally to methods and materials concerning diseases caused by Streptococcal pathogens, and in particular relating to attenuated strains of Streptococci and use of the same as vaccines. MICROORGANISM DEPOSIT [0002] A micro-organism deposit in accordance with the Budapest treaty has been at the National Collection of Type Cultures (NCTC), Health Protection Agency, Centre for Infections 61, Colindale Avenue, LONDON NW9 5EQ, United Kingdom under accession number: 13412 on date 26 Sep. 2007 on behalf of the present applicant by the present inventors. [0003] The depositors have authorised the present applicant to refer to the deposited biological material in the application. BACKGROUND ART [0004] Streptococcus is a genus of spherical shaped Gram-positive bacteria. Clinically, individual species of Streptococcus are classified primarily based on their Lancefield serotyping—according to specific carbohydrates in the bacterial cell wall. These are named Lancefield groups A to T. However the pathogens in these different groups share many similarities at the genetic level. For example Streptococcus equi (which is in group C, and which is the causative agent of equine strangles) shares 80% genome identity with the human pathogen S. pyogenes (which is in group A, and which is the causative agent of many human conditions including strep throat, acute rheumatic fever, scarlet fever, acute glomerulonephritis and necrotizing fasciitis). Additionally the two organisms share many near identical toxins and virulence factors. [0005] Streptococci are further characterised via their haemolytic properties. Alpha haemolysis is caused by a reduction of iron in haemoglobin giving it a greenish color on blood agar. Beta only haemolysis is complete rupture of red blood cells giving distinct, wide, clear areas around bacterial colonies on blood agar. Other streptococci are labeled as gamma haemolytic. [0006] Strangles is a disease characterised by nasal discharge and fever, followed by abscessation of local lymph nodes. The swelling of the lymph nodes in the head and neck may, in severe cases, restrict the airway and it is this clinical feature that gave the disease ‘strangles’ its name. Morbidity rates of up to 100% are reported and mortality as a result of disseminated abscessation ('bastard strangles') may occur in 10% of cases (Timoney, 1993a). Strangles is one of the most frequently diagnosed equine diseases worldwide. Recent outbreaks in Thoroughbreds have further highlighted the need for the development of improved therapies. Antibiotic treatment is usually ineffective despite S. equi's susceptibility to most antibiotics in vitro. Clinical signs following treatment have been reported to abate only until treatment is withdrawn. This relapse is probably due to the lack of sufficient vascularity in the abscess to enable antibiotic penetration to therapeutic levels and illustrates the importance of the development of an effective preventative vaccine (Harrington et al., 2002). Approximately 10% of horses that recover from strangles become carriers of the disease, harbouring the infectious agent in chondroids located in the guttural pouch. These carriers are capable of infecting other naïve horses and continue the spread of disease (Chanter et al., 2000, Newton et al., 1997, Newton et al., 2000). Therefore, a major goal of vaccine design is not only to protect against strangles, but also to prevent development of the carrier state. [0007] Progress in the development of an effective strangles vaccine has been slow. Vaccines against the disease have been known for a long time (Bazeley, 1940 and Bazeley, 1942), but have either proved ineffective or suffer from undesirable side effects. [0008] Four kinds of vaccines are available: a) vaccines based on classical bacterins, b) sub-unit vaccines based on the M-protein, an immunogenic protein, c) Chemically attenuated live Streptococcus equi and d) Genetically attenuated live Streptococcus equi. [0009] Conventional vaccines containing inactivated whole bacteria or extracts have shown little efficacy and often induce adverse reactions (Jorm, 1990, Timoney and Eggers, 1985). Classical vaccines based on bacterins or subunits are e.g. available through Fort Dodge Laboratories and Coopers Animal Health. [0010] Those vaccines that specifically target the M-protein of S. equi , showed promise in mouse vaccination challenge studies (Meehan et al., 1998), but failed to demonstrate significant protection in horses despite the generation of M-protein reactive antibodies (Timoney et al., 1997, Sheoran et al., 2002). [0011] Similarly, a recombinant S. equi hyaluronate associated protein (HAP) vaccine, was partially protective in mice (Chanter et al., 1999), but failed to prevent the development of strangles in vaccinated horses (N. Chanter unpublished results). [0012] The basis and duration of protective immunity following natural infection is not fully understood, but in the majority of animals that recover from strangles immunity is believed to last for >5 years (Hamlen et al., 1994; Sweeney et al., 2005; Todd 1910; Woolcock, 1975). [0013] A non-specifically attenuated vaccine strain for intranasal inoculation, the ‘Pinnacle I.N.’strangles vaccine, is marketed by Fort Dodge (Timoney, 1993b, http://www.wyethah.ca/wyeth_equine/pinnacle.html). This acapsular strain was derived following chemical mutagenesis to induce random mutations throughout the bacterial genome (Timoney, 1993b). Such non-defined point mutations are prone to back mutation and thus to reversion to full virulence and although this vaccine may protect up to 100% of horses (Timoney, 1993b, Walker and Timoney 2002), it has not been licensed for sale in Europe due to safety concerns. These include nasal discharge, lymphadenectasis and a 5% risk of submandibular abscesses following IN vaccination (Timoney, 1993b, http://www.wyethah.ca/wyeth_equine/pinnacle.html). US2006110411 (WYETH FORT DODGE LAB (US)) relates to compositions comprising live, attenuated S. equi. [0014] Recently, an Intervet live attenuated vaccine strain TW 928 has been approved for sale in Europe, marketed as ‘Equilis StrepE’. This strain was attenuated by the partial deletion of the aroA gene and was 10 4 -fold attenuated during intraperitoneal mouse challenge studies (Hartford et al., 1999, http://www.biosafety.be/EMEA/Table_EquilisStrepT.htm). The TW 928 vaccine strain was attenuated in six horses with no signs of disease apparent at post mortem examination four weeks after intranasal challenge (Hartford et al., 1999). Intramuscular vaccination of horses with strain TW 928 conferred 100% protection from subsequent S. equi challenge. However, severe injection site reactions precluded the use of this route for future studies. Further, contamination of needles to be used for the administration of other products with the Equilis StrepE vaccine have also led to abscess formation at the intramuscular injection site (Kemp-Symonds et al., 2007). [0015] In order to minimise injection site reactions and retain some protective efficacy, sub-mucosal vaccination with 10 9 cfu of the TW 928 strain into the inside of the upper lip was evaluated. Using this method, small pustules formed over a period of one week from which the TW 928 strain could be isolated. Horses were 50% protected from intranasal S. equi challenge and a further 25% of vaccinates had reduced clinical signs of disease. The presence of these pustules may be critical for the generation of an efficacious immune response since on dose reduction reduced injection site reactions correlated with decreased protection (Jacobs et al., 2000). [0016] We have also observed cases of sub-mandibular lymph node abscessation in horses recently vaccinated with Equilis StrepE. In three of these cases we have confirmed by genetic analysis that the causal agent was the vaccine strain (Kemp-Symonds et al., 2007; Waller et al., unpublished data). [0017] In addition, an undetermined proportion of the 25% of vaccinated horses, which on exposure to virulent S. equi suffer reduced clinical signs may go on to become carriers of virulent field strains of S. equi without being diagnosed. Such a scenario is of major concern to disease prevention strategies. [0018] Finally, the vaccine suffers from only a 3-month duration of immunity, although boosting of horses vaccinated up to six months previously in the face of an outbreak has been shown to improve clinical outcome and extends the usefulness of this vaccine. [0019] Overall, ‘Equilis StrepE’ is a promising advance over the Pinnacle strain (most notably in its lower risk of reversion). However, it is only recommended for use in horses of high or moderate risk of strangles where acquisition of a short duration of immunity is advantageous (http://www.wyethah.ca/wyeth_equine/pinnacle.html). Additionally it suffers a number of drawbacks as discussed above. [0020] It will be appreciated that novel vaccine strains which could overcome one or preferably more than one of these drawbacks would provide a contribution to the art. DISCLOSURE OF THE INVENTION [0021] The present inventors have considered the drawbacks in the prior art above and have determined that greatest protection against Streptococcal pathogens may be achieved by use of preferably live attenuated strains which generate an immune response to multiple protective epitopes presented in a context most resembling the live pathogen. [0022] Such strains are provided herein. [0023] In respect of strangles vaccines, the attenuated vaccines described herein may offer improved efficacy, intramuscular safety, have a generally improved safety profile, and may not cause the occasional lymph node abscessation found with the prior art. [0024] In one embodiment there is disclosed herein [0025] A Streptococcus vaccine strain comprising the following modifications in its genome: (i) attenuation of one or more essential biosynthetic genes, (ii) attenuation of one or more genes which encode a haemolytic toxin, or a protein involved in the production thereof, plus preferably any one, two, or most preferably three of the following modifications: (iii) attenuation of one or more genes which encode a protein responsible for immune evasion, (iv) modification of one or more genes such as to permit serological discrimination of the vaccine strain based on analysis of a protein encoded by said genes, and (v) attenuation of one or more genes which encode an enzyme responsible for recombination repair of the genome. [0031] By “attenuation” is meant modification of the sequence of relevant gene and hence impairment of the function or activity of the encoded protein. Preferred attenuations are deletion of all or part of the gene, or the introduction of substitutions therein. Preferably attenuation is achieved by at least one well-defined irreversible deletion of substantial size. [0032] Those skilled in the art will appreciate that the strains of the present invention may combine one or more further attenuations in addition to those described above. [0033] Some particular aspects and embodiments of the invention will now be discussed in more detail. Biosynthetic Genes [0034] The inventors have determined that attenuation of S. equi TW 928 by the deletion of only one gene may not remove the possibility of strain reversion. Acquisition of homologous DNA from the commensal S. zooepidemicus followed by recombination and repair of the TW 928 genome remains a small, but unknown risk factor in the use of this strain in equids. [0035] Preferably therefore two essential biosynthetic genes are attenuated. Preferably the genes are partially or fully deleted. [0036] Preferred target biosynthetic genes are those in the aromatic or pyramidine (or purine) pathways. Preferred genes are aroB and pyrC. [0037] Deletion of genes in the aromatic amino acid biosynthetic pathway is known to attenuate pathogens and has been used to generate the TW 928 S. equi strain and several non-streptococcal vaccine strains (http://www.biosafety.be/EMEA/Table_EquilisStrepT.htm, Ingham et al., 2002, Simmons et al., 1997, Chamberlain et al., 1993, Alexander et al., 1993, Vaughan et al., 1993, Karnell et al., 1992, Newland et al., 1992, Stocker 1990, Izhar et al., 1990). [0038] Purine and pyrimidine biosynthesis have been targets for attenuation of pathogenic E. coli (Kwaga et al., 1994) and inactivation of pyrC is known to prevent growth of B. subtilis in minimal media (Waller et al., 2001). Haemolytic Toxin [0039] As noted above the relevant gene may encode the toxin or a protein involved (or more preferably required) for the efficient production thereof, such that the attenuation reduces the level of toxin produced. Preferably one such gene is partially or fully deleted. [0040] A preferred gene is the sagA gene, essential to production of the streptolysin S haemolytic toxin. Work in Streptococcus pyogenes has identified that injection site lesions could be reduced by inactivation of the SLS haemolytic toxin in this Group A Streptococci (Betschel et al., 1998). Immunogenicity [0041] The attenuation of genes leading to immune evasion will lead to increased immunogenicity. [0042] Immune evasion in this context is used broadly to cover situations both in which an immune response is directly suppressed, and also where it is misdirected—for example by so-called “superantigens”, which exhibit highly potent lymphocyte-transforming (mitogenic) activity directed towards T lymphocytes. [0043] Example genes may encode enzymes or other proteins involved in production of the hyaluronate capsule. [0044] Preferably one such gene is partially or fully deleted. [0045] A preferred gene is the hasA gene which has been described in relation to Streptococcus pyogenes (Dougherty and van de Rijn 1994, Wessels et al., 1994). [0046] Other preferred genes may encode superantigen toxins. Although these are toxins in their own right, it is believed that their primary effect may be to misdirect the immune response. Examples of such genes are seeH, seeI, seeL and seeM (Artiushin et al., 2002, Proft et al., 2003). Deletion or truncation of these genes therefore increases the immunogenicity of the vaccine. [0047] Other preferred genes, slaA and slab encode putative phospholipase A2 toxins, which have homology with a gene recently identified in S. pyogenes (Beres et al., 2002). These are likewise believed to be virulence factors, which exert a profound effect on the proinflammatory cascade as well as having neurotoxic, myotoxic and anticoagulant properties. [0048] Preferably 1, 2, 3, 4, 5, 6 or all 7 of these genes are attenuated. Serological Discrimination [0049] The modification of one or more genes which permit serological discrimination of the vaccine strain may be useful in differentiating vaccinated subjects from those exposed to virulent pathogens. This permits the evaluation of the contribution of the vaccination to disease prevention and in the management of outbreaks in vaccinated populations. [0050] A preferred target gene is that which encodes the M protein. [0051] Vaccines based on the full length M-protein have previously shown poor efficacy in horses despite excellent immunogenicity (Sheoran et al., 2002). Truncation such as to remove regions of the IgG and\or fibrinogen binding functional domains may further attenuate the vaccine strain (see also Meehan et al., 2000, Meehan et al., 2001). Lack of the fibrinogen and IgG binding domains may lower the risk of induction of the immune complex disease purpura haemorrhagica occasionally associated with strangles and strangles vaccines, including those based on the M-protein (Galan and Timoney 1985, Pusterla et al., 2003, Herwald et al., 2004). [0052] Other preferred target genes encode the superantigen toxins seeH, seeI, seeL and seeM (Artiushin et al., 2002, Proft et al., 2003; see above). Recombination Repair [0053] Example genes may encode recombinases or other nucleic acid modifying enzymes responsible for repair or recombination. Preferably one such gene is partially or fully deleted such as to reduce the possibility of strain reversion i.e. when the above are combined with impairment of an enzyme responsible for recombination repair of the genome a live attenuated vaccine essentially incapable of repairing the attenuating deletions may be achieved. [0054] A preferred gene is the recA gene (Tao et al., 1995). Deletion of recA may have the added advantage of increasing the sensitivity of the vaccine strain to UV light, decreasing the likelihood of environmental persistence. Preferred Strains [0055] Thus preferred strains may combine modifications (i) and (ii) with one or more of (iii), (iv) and (v), preferably two of (iii), (iv) and (v), most preferably all three of (iii), (iv) and (v). [0056] Preferably the strain will be engineered such that no plasmid DNA or antibiotic resistance genes remain present, such as to maintain the same sensitivity to antibiotics as the parental strain. [0057] Preferably the Streptococcus is a Beta-haemolytic streptococcus , for example in Lancefield group C—however as noted above Streptococcus pathogens share significant genetic identity and hence express near identical toxins and virulence factors. [0058] In one embodiment the Streptococcus is S. equi which is causative of strangles. The present inventors have rationally selected and designed a combination of the above modifications to generate a novel live attenuated vaccine strain known as “SHMAPR” that can be more widely applied throughout the equine community. This combines the following properties: [0059] To reduce injection site reactions and improve safety, the sagA gene was partially deleted. To improve the immunogenicity, the hasA gene was partially deleted. Consequently, the train appears non-haemolytic and non-mucoid on blood agar plates and so is readily distinguished from wild-type strains. [0060] It should be noted that deletion of the aroA gene (see above) would enable the strain to be differentiated at a genetic level from virulent S. equi (Kelly et al., 2006). However, as this gene has a near identical homologue in S. zooepidemicus , it cannot be utilised to develop a differential diagnostic ELISA to rapidly determine if vaccinated animals have seroconverted on subsequent exposure to strangles. To enable serological discrimination between vaccinated and naturally infected horses the M-protein was C-terminally truncated. To attenuate the strain the genes aroB and pyrC were partially deleted although despite this partial deletion the vaccine strain grows well in rich media. Finally, to further reduce the possibility of strain reversion the recA gene was partially deleted. [0061] The SHMAPR S. equi vaccine strain was attenuated when administered via the IN, IM and subcutaneous (SC) routes in a mouse infection model. IN challenge of 30 mice, with 4×10 6 colony forming units (cfu) of the SHMAPR strain did not cause any signs of disease (Example 3). IM challenge of 5 mice, with 4×10 6 colony forming units (cfu) of the SHMAPR strain did not cause any signs of disease distal to the injection site and injection site reactions did not exceed the mild severity limit (Example 4). SC vaccination of mice with 10 5 or 10 6 cfu of the SHMAPR vaccine strain was also well tolerated. All 5 mice gained weight during the course of the study (Example 5). The majority of IM and SC vaccinated mice developed small pustules at the injection site containing live SHMAPR bacteria, indicative of immune recognition. Such short-term persistence of bacteria is likely to be beneficial for induction of immunity and has previously been noted for TW 928 in horses. Recovered bacteria maintained the non-haemolytic and acapsular phenotypes, confirming the in vivo stability of these deletions. In contrast, mice receiving similar doses of the wild type 4047 strain via the IN or IM routes fell ill and were all euthanased on ethical grounds within 24 hours. In this model an IN 4047 challenge dose of 10 3 cfu induced disease in 4/5 mice within one week. Therefore, the SHMAPR vaccine strain is non-toxic and >5×10 3 -fold attenuated when compared to the parental strain in mice by IN challenge. [0062] The SHMAPR live attenuated vaccine was also found to be safe in six ponies by intranasal and intramuscular administration at doses of 1×10 9 cfu and up to 1×10 9 cfu, respectively (Example 6). This intranasal dose of virulent S. equi 4047 has previously been shown to induce disease in 96% of control ponies (Hamilton et al., 2006, Waller et al., 2007 and Waller unpublished data). [0063] The intranasal vaccination phase proceeded without incident. No significant injection site reactions were observed in any of the six ponies intramuscularly vaccinated with the SHMAPR live attenuated vaccine. [0064] Thus vaccines as described herein may combine stability, safety and immunogenicity such as to permit for the possibility of intramuscular vaccination with reduced risk of harmful side effects or strain reversion. It will be appreciated that given the similarities of strategies of various Streptococcal pathogens, corresponding changes in other strains may likewise be expected to provide the benefits disclosed herein. Thus in another embodiment, the invention provides SHMAPR-modified vaccines based on non- S. equi strains, for example those shown in Table 7. [0065] In Tables 7a and 7b homologues of certain preferred target genes described herein are described. [0066] Referring to the Tables, where sequencing of the relevant strains has not yet been performed (“not available”) it will be appreciated that those skilled in the art can nevertheless practice the present invention (in the light of the present disclosure) by identifying the homologues by conventional methods—for example PCR, blotting or the like (see, for example, Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al, 1989). The identification of such genes does not per se form part of the invention. [0067] Referring to the Tables, if a homolog of a gene is believed not to be present in the relevant strain (“none”) then it will be appreciated that modification of that gene in that strain is not required by the present invention. [0068] Other particular preferred strains include also those strains shown in Table 8. [0069] In one aspect, the invention provides S. equi strain SHMAPR, as deposited at the National Collection of Type Cultures (NCTC), Health Protection Agency, Centre for Infections 61, Colindale Avenue, LONDON NW9 5EQ, United Kingdom under accession number: 13412. [0070] Thus in all aspects and embodiments described herein (e.g. strains, methods, processes, vaccines) this is optionally a preferred strain. [0071] The invention further relates to a microbiological pure culture comprising bacteria according to the deposited strain. It goes without saying that next generations of bacteria from the deposited strain are also included. [0072] The culture can e.g. be obtained by growing said bacteria at a temperature between 30 and 41° C. Bacteria can be grown e.g. in Todd Hewitt medium. Production of Vaccines [0073] The invention further provides a process for producing a Streptococcus vaccine strain, which process comprises: [0000] (a) making the following modifications to its genome: (i) attenuation of one or more essential biosynthetic genes, (ii) attenuation of one or more genes which encode a haemolytic toxin, or protein involved in the production thereof, plus preferably any one, two, or most preferably three of the following modifications: (iii) attenuation of one or more genes which encode a protein responsible for reduced immunogenicity, (iv) modification of one or more genes such as to permit serological discrimination of the vaccine strain based on analysis of a protein encoded by said genes, and (v) attenuation of one or more genes which encode an enzyme responsible for recombination repair of the genome. (b) optionally culturing the resulting strain. [0079] The choice of genes may include any of those described above. As noted above, well-defined and deliberately made mutations involving the deletion of fragments of the gene or even the whole gene or the insertion of heterologous DNA-fragments or both, have the advantage, in comparison to classically induced mutations, that they will not readily revert to the wild-type situation. Thus, in one embodiment, the attenuation is deletion of at least 100 nucleotides. In one embodiment the deletion corresponds to that shown in any of Sequence Annexes 1-6. Optionally the primers described in the Examples hereinafter may be used in the preparation of deletions. These primers and their use in the process of this aspect thus form another aspect of the invention. [0080] The vaccine strain (optionally obtained from culturing as described above, or from the relevant depositary institution) may be used in a process to prepare a vaccine, whereby it is combined with a pharmaceutically acceptable carrier. [0081] The vaccine may be freeze dried, as described in more detail below. [0082] The invention further provides a vaccine for vaccination against a Streptococcal pathogen as described herein comprising live bacteria of any Streptococcus attenuated vaccine strain described above and a pharmaceutically acceptable carrier. Such a carrier may be as simple as water, but it may e.g. also comprise culture fluid in which the bacteria were cultured. Another suitable carrier is e.g. a solution of physiological salt concentration. [0083] Methods and Uses of Vaccines [0084] In all vaccines, methods and uses described herein the vaccine is preferably a live vaccine. However use of inactivated (killed) vaccine formulations is also embraced by the present invention, should that be preferred by the user. [0085] The invention further provides a method for immunising a subject against a Streptococcal pathogen, which method comprises administering to said subject the respective Streptococcus attenuated vaccine strain described above in sufficient amount to raise a protective immune response thereto. [0086] “Respective” in this context means either the Streptococcal pathogen which was attenuated to produce the vaccine strain, or a different pathogen which is sufficiently immunologically cross reactive such that the vaccine strain provides protection therefrom. [0087] For example in one embodiment an S. equi vaccine strain may be used for combating Streptococcus equi or Streptococcus zooepidemicus infection in horses. [0088] Preferably the method is for vaccination against a disease shown in Table 7, by use of the appropriate live vaccine strain prepared according to the present invention. [0089] It will be appreciated by those skilled in the art that immunisation, or protection, in this context does not necessarily circumscribe complete success (i.e. that a subject so vaccinated would never be susceptible to infection by said pathogen). Rather it is used in its art-recognised sense to be a prophylactic measure with the aim of mitigating the severity of, or reducing the incidence of, said infection. [0090] Strains described herein may be “avirulent” by which it would be understood not to be able to cause the relevant disease in the subject and includes those which a person of skill in the art would consider safe for administering to the subject as a vaccine. For example, in the context of a strangles vaccine, a strain causing minor clinical signs, including fever, serous or mucopurulent nasal discharge or ocular discharge, is within the scope of the present invention since such clinical signs are considered acceptable vaccine side effects. [0091] In other aspects the invention provides: [0092] Use of Streptococcus attenuated vaccine strain described above in sufficient amount to raise an immune response thereto in a method for immunising a subject against the respective Streptococcus pathogen; [0093] A Streptococcus attenuated vaccine strain described above for use in a method for immunising a subject against the respective Streptococcus pathogen; [0094] Use of Streptococcus attenuated vaccine strain described above in the preparation of a medicament for immunising a subject against the respective Streptococcus pathogen. The medicament may comprise a sufficient amount or dose to raise an immune response thereto in the subject. [0095] Modes of Administration and Dosage [0096] A vaccine according to the present invention can be administered in various forms. It can e.g. be administered parenterally, e.g. intramuscularly, subcutaneously or intradermally, it can also be given orally, submucosally (e.g. in the lip) or it can be given intranasally. [0097] In respect of strangles, the nasal mucosa is the most common porte d'entree for Streptococcus equi infection. Therefore, the nose is the most natural place for the application of the live attenuated vaccine according to the invention. In addition, this application site has the advantage that it is easily reached, and that the vaccine can e.g. be administered by spraying. Thus, in one preferred form, the vaccine of the present invention is suitable for intranasal application. Other vaccines are commonly administered via the intramuscular route. The SHMAPR live attenuated vaccine has been specifically designed such that this route can be utilised. Therefore, in another preferred form, the vaccine of the present invention is suitable for intramuscular application. Due to its attenuated characteristics, the vaccine can be used to protect horses at any age, including young horses e.g. between 6 and 12 months of age. [0098] A vaccine according to the present invention may comprise any dose of bacteria, sufficient to evoke an immune response. Doses ranging between 10 3 and 10 9 bacteria are e.g. very suitable doses. [0099] A vaccine according to the present invention may comprise any volume of bacteria, suitable for the route of administration selected. Volumes ranging between 0.2 ml and 2 ml bacteria are e.g. very suitable for intramuscular administration. Volumes ranging between 2 ml and 20 ml bacteria are e.g. very suitable for intranasal administration. [0100] A vaccine according to the present invention may be administered using a variety of different dosing regimens, sufficient to evoke an immune response. Doses administered between 2 and 12 weeks are e.g. very suitable for naïve animals. Doses administered between 12 and 52 weeks are e.g. very suitable for primed animals. Storage [0101] There are several ways to store live organisms. Storage in a refrigerator is e.g. a well-known method. Also often used is storage at −70° C. in a buffer containing glycerol. Bacteria can also be kept in liquid nitrogen. Freeze-drying is another way of conservation. Freeze-dried bacteria can be stored and kept viable for many years. Storage temperatures for freeze-dried bacteria may well be above zero degrees, without being detrimental to the viability. Freeze-drying can be done according to all well-known standard freeze-drying procedures. [0102] Optional beneficial additives, such as e.g. skimmed milk, trehalose, gelatin or bovine serum albumin can be added in the freeze-drying process. Therefore, in a more preferred form, the vaccine is in a freeze-dried form. Other Vaccine Constituents [0103] In another embodiment, the vaccine of the present invention additionally comprises another attenuated pathogen or antigenic material from another pathogen. Such a pathogen may e.g. be another bacterium or a parasite. Also it can be of viral origin. Usually, the other pathogen or antigenic material thereof will be a horse pathogen. A vaccine according to the invention that also comprises such an additional attenuated pathogen or antigenic material from another pathogen has the advantage that it induces protection against several infections at the same time. Horse pathogens or antigenic material thereof that can advantageously be added are e.g. Potomac fever agent, Rhodococcus equi, Clostridium botulinum Clostridium tetanii, Burkholdiera mallei, Streptococcus zooepidemicus , Vesicular Stomatitis Virus, Borna disease virus, Equine influenza virus, African horse sickness virus, Equine arteritis virus, Equine herpesvirus 1-4, Infectious anemia virus, Equine encephalomyelitis viruses (Eastern, Western and Venezuelan), West Nile virus, Rabies virus, Hendra disease virus and Japanese B encephalomyelitis virus. [0104] The vaccine may also comprise an adjuvant. Adjuvants are non-specific stimulators of the immune system. They enhance the immune response of the host to the invading pathogen. Examples of adjuvants known in the art are Freunds Complete and Incomplete adjuvant, vitamin E, non-ionic block polymers, muramyldipeptides, ISCOMs (immune stimulating complexes, cf. for instance EP 109942), Quill A, mineral oil, vegetable oil, and Carbopol (a homopolymer). [0105] Adjuvants, specially suitable for mucosal application are e.g. the E. coli heat-labile toxin (LT) or Cholera toxin (CT). [0106] In addition, the vaccine may comprise one or more stabilisers. Also, the vaccine may comprise one or more suitable emulsifiers, e.g. Span or Tween. [0107] Thus in all aspects and embodiments described herein (e.g. strains, methods, processes, vaccines) the following may optionally be included along with the vaccine strain: [0000] a) Stabilising proteins to facilitate freeze-drying e.g. any described above. b) Adjuvant e.g. selected from the group consisting of E. coli heat-labile toxin and Cholera toxin. c) Other attenuated pathogen or antigenic material from another pathogen, as appropriate to the subject to be treated (i.e. to product a multivalent vaccine). For example, a multivalent vaccine suitable for use in horses may include attenuated pathogen or antigenic material therefrom, from the group consisting of Potomac fever agent, Rhodococcus equi, Clostridium botulinum Clostridium tetanii, Burkholdiera mallei, Streptococcus zooepidemicus , Vesicular Stomatitis Virus, Borna disease virus, Equine influenza virus, African horse sickness virus, Equine arteritis virus, Equine herpesvirus 1-4, Infectious anemia virus, Equine encephalomyelitis viruses (Eastern, Western and Venezuelan), West Nile virus, Rabies virus, Hendra disease virus and Japanese B encephalomyelitis virus. [0108] The resulting strains, methods, processes, vaccines etc. including one or more of these things form other aspects of the invention. [0109] Any sub-titles herein are included for convenience only, and are not to be construed as limiting the disclosure in any way. [0110] The invention will now be further described with reference to the following non-limiting Figures and Examples. Other embodiments of the invention will occur to those skilled in the art in the light of these. [0111] The disclosure of all references cited herein, inasmuch as it may be used by those skilled in the art to carry out the invention, is hereby specifically incorporated herein by cross-reference. FIGURES [0112] FIG. 1 : Relative location of the primers described in the Examples below. [0113] FIG. 2 : Mean % change in mass following intranasal challenge with S. equi 4047 or SHMAPR. Error bars indicate 95% confidence intervals. [0114] FIG. 3 : Mean % change in mass following intramuscular challenge with S. equi 4047 or SHMAPR. Error bars indicate 95% confidence intervals. [0115] FIG. 4 : Mean % change in mass following subcutaneous challenge with 1×10 6 or 1×10 5 cfu of S. equi SHMAPR. Error bars indicate 95% confidence intervals. [0116] FIG. 5 : Mean pathology score in control and SHMAPR challenged ponies. Control data represents the mean of 4 independent challenges with S. equi 4047 in a total of 23 ponies (Hamilton et al., 2006, Waller et al., 2007 and Robinson, unpublished data). Error bars represent the 95% confidence interval. [0117] FIG. 6 : Mean rectal temperature. Error bars indicate 95% confidence interval. [0118] FIG. 7 : Mean pathology score. Error bars indicate 95% confidence interval. SEQUENCE ANNEXES 1-6 [0119] Sequence Annex 1—sagA deletion: Sequence Annex 2—hasA deletion: Sequence Annex 3—seM deletion: Sequence Annex 4—aroA deletion: Sequence Annex 5—pyrC deletion: Sequence Annex 6—recA deletion: EXAMPLES Example 1 Selection of a Mutant Strain [0120] An example vaccine was derived from a field isolate of Streptococcus equi responsible for causing strangles in a New Forest pony in Hampshire in 1990 and is the subject of the Streptococcus equi genome-sequencing project (http://www.sanger.ac.uk/Projects/S_equi/). The field strain was designated strain 4047. This strain was grown overnight, aerobically at 37° C., on blood agar and then inoculated in Todd Hewitt medium and subjected to well-described DNA mutation techniques (Maguin et al., 1992) to achieve the desired vaccine characteristics. [0121] Briefly, the partial deletion of each target gene was performed as follows: [0122] Upstream and downstream pieces of DNA homologous to the target gene were cloned into the pGhost9 plasmid via EcoRI and SalI restriction sites to create a copy of the target gene lacking the desired internal portion of the coding sequence. Details of the primers used to generate the required plasmids, the section of the genes to be deleted and a schematic for primer use can be found in Tables 1 and 2 and FIG. 1 . [0123] pGhost9 plasmid containing the desired homologous DNA was then transformed into competent Streptococcus equi strain 4047 via electroporation and strains containing the plasmids were grown for 48 hours at 28° C. on Todd Hewitt medium with 0.5 μg of erythromycin per ml. An overnight (16 h) culture was diluted 100-fold in Todd Hewitt medium containing erythromycin and incubated at 28° C. until on OD 600 of 0.3 was reached (mid exponential phase). The culture was then shifted to 37.5° C. for 150 min to initiate integration of the plasmid in to the chromosome by homologous recombination, as the plasmid can not replicate at 37° C. [0124] Samples were diluted and plated at 37° C. on Todd Hewitt agar containing 0.5 μg of erythromycin per ml (to identify insertion mutants) and without erythromycin (to determine the viable cell count). Integration of the plasmid into the chromosome was confirmed by PCR. [0125] To excise the inserted vector and generate the desired gene deletion, insertion mutants were grown overnight in Todd Hewitt medium (without erythromycin) at 37° C. The culture was then diluted 10 3 -fold in Todd Hewitt medium and incubated at 28° C. without erythromycin, until stationary phase (about 18 h); this step stimulates recombination by allowing plasmid replication. Cultures were then diluted and plated without erythromycin at 37° C., to allow loss of the excised plasmid. Colonies were transferred with toothpicks to selective (containing 0.5 μg of erythromycin per ml) and non-selective plates. Colonies in which excision had occurred were phenotypically erythromycin sensitive. [0126] Deletion mutant strains were identified by PCR across the desired deletion site. In such experiments a smaller target gene DNA fragment was amplified from the desired deletion mutant strain when compared with the parental Streptococcus equi 4047 strain (Table 2). [0127] Each gene was deleted sequentially in the order sagA, hasA, seM, aroB, pyrC and recA. recA was deleted last as the deletion process requires the presence of the recA gene product. [0128] A strain with deletions in the genes sagA, hasA, seM, aroB, pyrC and recA was selected and designated SHMAPR. PCR was performed across each of the deleted target genes using the primers in Table 1 and the products purified and sequenced on an ABI3100 automated sequencer using well-described protocols to confirm that the desired deletions had been generated. Details of each deletion generated are presented in Table 2. [0129] Owing to deletion of part of the sagA gene, the SHMAPR strain appears non-haemolytic on blood agar plates. [0130] Owing to deletion of part of the hasA gene, the SHMAPR strain appears non-mucoid on agar plates and sediments in liquid culture. [0000] TABLE 1 Target gene Primer name Primer sequence sagA 5′sagA 1 GGG GAATTC TGAGGTACTAGCCATCTGTC sagA NDEL 2 GGG AAGCTT AGCAAATTGTAACATAATGCTTACC sagA CDEL 3 GGG AAGCTT GCTGAGCCAAAAGCGTAAAC 3′sagA 4 GGG GTCGAC AAAACTCAGCCACACTGGTC hasA 5′hasA2 1 GGG GAATTC AAGGGAAGGGCTGGGCAATATAAGG hasA NDEL 2 GGG GATATC ATTTCTGACATTAAGGTGACCCGTC hasA CDEL 3 GGG GATATC TGGAACAAGTCCTTCTTTAGAGAG 3′hasA2 4 GGG GTCGAC AGGGCTGTAGGACAAACAAATGCAG seM 5′SEM stop 1 GGG GAATTC ATGTTTTAGAGAAATAACAAGC SEM NDEL stop 2 GGG GATATC ATTTTACATCGATGAAAGGTG SEM CDEL stop 3 GGG GATATC TGAGATGCTAAGGTAGCAGAGC 3′SEM CENT 4 GGG GTCGAC GTTTTCTTTGCGTTTAGGAGACACC aroB ASW31 1 GAC GAATTC TGTCTGAAAGGCAGCTAGAG ASW32 2 GAC GACGAT ATCGGATAGTCATTGATACGAGAC ASW33 3 GCTA GATATC GCCTGAGAAGGCT ASW34 4 GACGAC GTCGAC TGGTAAGACCTGGACAACAG ZM24 5 ACACCTGATCTTGCCTTGTC pyrC ASW35 1 GAC GAATTC GCAGCAGATATTGGAGTAAGG ASW36 2 GACGAC AAGCTT GCCACCTGATCTAGCTGTGAT ASW37 3 GACGAC AAGCTT AGCGTTTGGTAACAGAAGCC ASW38 4 GACGAC GTCGAC TACGTTTCGGATTCTTGGGC ZM23 5 GGCAGGCTATTATGGCTAAG recA ASW57 1 GACGAC GAATTC TTATTGCTTGCTAGTCAGCC ASW58 2 GACGAC GATATC AAGGCTGCAATACCACCTTC ASW59 3 GACGAC GATATC GAAGGCATCTCACGTACAGG ASW60 4 GACGAC GTCGAC TTGACGATCGCTGTTAAGCC 5 Additional primer used for sequencing. Restriction sites used for cloning are underlined [0000] TABLE 2 Size of Size of Target deleted 4047 strain Gene Deletion Deletion gene PCR product PCR product size generated size sagA 945 bp 1071 bp  165 bp 16 bp to 126 bp 141 bp hasA 722 bp 1033 bp 1254 bp 577 bp to 311 bp 888 bp seM 810 bp 1620 bp 1605 bp 349 bp to 810 bp 1158 bp aroB 1243 bp  2270 bp 1083 bp 46 bp to 1027 bp  1073 bp pyrC 1387 bp  2472 bp 1413 bp 204 bp to 1085 bp  1288 bp recA 731 bp 1257 bp 1152 bp 330 bp to 526 bp 855 bp [0131] The SHMAPR vaccine strain was then tested for its attenuated character as described in the Examples below. Example 2 Preparation of Vaccine [0132] Streptococcus equi strain SHMAPR and the wild type parent 4047 strain were grown overnight, aerobically at 37 degree. C., on blood agar and then inoculated in Todd Hewitt medium containing 10% foetal calf serum. For the vaccination/challenge studies, the strains were cultured for 6 hours at 37 degree. C. in 100 ml of Todd Hewitt medium containing 10% foetal calf serum to an OD 600nm of 0.3. At this density the viable number of S. equi is 2×10 8 cfu/ml. Example 3 Intranasal Safety Test of the Vaccine Strain SHMAPR in Mice [0133] In this example, the rate of attenuation of the S. equi SHMAPR as compared to the wild-type strain 4047 has been tested in mice. 4×10 8 CFU of the mutant strain as well as the parent 4047 wild-type strain were applied intranasally to mice and mortality was recorded. Animals [0134] BALB/c mice, 4 weeks of age, obtained from Charles River Ltd, were used for the experiment. Vaccination/Challenge Cultures [0135] Streptococcus equi strain SHMAPR and the wild type parent 4047 strain were grown overnight, aerobically at 37° C., on blood agar and then inoculated in Todd Hewitt medium containing 10% foetal calf serum. The strains were then cultured for 6 hours at 37° C. in 20 ml of Todd Hewitt medium containing 10% foetal calf serum to an OD 600nm of 0.3. At this density the viable number of S. equi is 2×10 8 cfu/ml. Treatment [0136] At 4 weeks of age, 1 group of 30 mice sedated with 100 mg/kg ketaset, was challenged intranasally (20 μl) with 4×10 6 cfu S. equi strain 4047 and 1 group of 30 mice sedated with 100 mg/kg ketaset, was treated intranasally with 4×10 6 cfu S. equi strain SHMAPR. [0137] After the treatments, clinical signs of disease, weight loss and mortality was recorded for 5 days. Histopathological examination of all mice was used to determine the extent of disease progression. Results: [0138] The results after intranasal challenge of 4 weeks old mice with 4×10 8 cfu strain 4047 or strain SHMAPR are shown in Table 3. [0139] A severe infection in 28/30 mice challenged with the 4047 strain was observed within 24 hours. All mice in the wild type challenge groups were humanely euthanased at or before 24 hours after initial challenge. On post mortem examination, it was apparent that these mice had died from pneumonia and septicaemia rather than the more classical clinical course of strangles. [0140] None of the 30 mice challenged with an identical dose of S. equi SHMAPR showed any clinical signs of disease. All mice continued to gain weight ( FIG. 2 ). Histopathological examination of all mice 5 days post infection identified only mild signs of infection in 6/30 mice. [0000] TABLE 3 Number Clinical Histopa- of signs of thological Group mice Route Dose Mortality disease disease 4047 30 IN 4 × 10 6 30 28 29 (on day 1) SHMAPR 30 IN 4 × 10 6  0 0 6 (by day 5) Conclusions [0141] Other experiments following the same methods for strain preparation and administration have determined that an intranasal dose of 1×10 3 cfu of S. equi 4047 was sufficient to induce clinical disease in 4 of 5 mice at 5 days post challenge (Waller, unpublished data). Therefore, the SHMAPR strain is over 5×10 3 -fold attenuated in the intranasal mouse challenge model. The mild histological signs identified in 6/30 SHMAPR challenged mice indicates that this strain can stimulate an immune response in mice. Example 4 Intramuscular Safety Test of the Vaccine Strain SHMAPR in Mice [0142] In this example, the rate of attenuation of the S. equi SHMAPR as compared to the wild-type strain 4047 has been tested in mice. 4×10 6 CFU of the mutant strain as well as the parent 4047 wild-type strain were applied intramuscularly into the left leg of mice and mortality was recorded. Animals [0143] BALB/c mice, 4 weeks of age, obtained from Charles River Ltd, were used for the experiment. Vaccination/Challenge Cultures [0144] Streptococcus equi strain SHMAPR and the wild type parent 4047 strain were grown overnight, aerobically at 37° C., on blood agar and then inoculated in Todd Hewitt medium containing 10% foetal calf serum. The strains were then cultured for 6 hours at 37° C. in 20 ml of Todd Hewitt medium containing 10% foetal calf serum to an OD 600nm of 0.3. At this density the viable number of S. equi is 2×10 8 cfu/ml. Treatment [0145] At 4 weeks of age, 1 group of 5 mice was challenged intramuscularly (20 μl) with 4×10 8 cfu S. equi strain 4047 and 1 group of 5 mice was challenged intramuscularly (20 NI) with 4×10 8 cfu S. equi strain SHMAPR. [0146] After the treatments, clinical signs of disease, weight loss and mortality was recorded for 5 days. Histopathological examination of all mice was used to determine the extent of disease progression. Results: [0147] The results after intramuscular challenge of 4 weeks old mice with 4×10 8 cfu strain 4047 or strain SHMAPR are shown in Table 4. [0148] On day 1, all 5 mice injected IM with S. equi 4047 had severe swelling of their left leg and had ruffled coats. All of these mice looked very ill and were euthanased. All 5 mice injected with the SHMAPR strain developed swollen left legs, but remained active throughout the study. By day 5 one mouse had resolved its mild injection site reaction. All S. equi SHMAPR challenged mice gained weight as normal during the study period ( FIG. 3 ). [0149] On post mortem examination, 1 mouse challenged with S. equi 4047 had developed histological disease away from the injection site. None of the 5 mice challenged with an identical dose of S. equi SHMAPR had histological signs distal to the injection site. 4 SHMAPR vaccinated mice had small injection site pustules 5 days post challenge, from which the original S. equi SHMAPR strain was isolated, highlighting that the SHMAPR strain can persist for a short time at the injection site. [0000] TABLE 4 Number Clinical Histopa- of signs of thological Group Route Dose mice Mortality disease disease 4047 IM 4 × 10 6 5 5 5 1 (on day 1) SHMAPR IM 4 × 10 6 5 0 0 0 (by day 5) Conclusions [0150] The S. equi SHMAPR strain produced dramatically less disease and injection site swelling than S. equi 4047 when injected intramuscularly. The SHMAPR strain could persist at the injection site for a short period of time, which may enhance the stimulation of the immune system. Injection site reactions in mice did not cause any clinical signs of disease and mice continued to gain weight normally during the study period. Therefore, the SHMAPR live attenuated vaccine appears ideally suited for intramuscular administration. Example 5 Subcutaneous Safety Test of the Vaccine Strain SHMAPR in Mice [0151] In this example, the safety of two doses of the S. equi SHMAPR was tested in mice. 1×10 6 or 1×10 5 CFU of the mutant strain were applied subcutaneously into the neck scruff of mice and mortality was recorded. No mice were challenged subcutaneously with parental strain 4047 because of the severe disease observed in earlier intranasal and intramuscular challenges with this strain. Animals [0152] BALB/c mice, 4 weeks of age, obtained from Charles River Ltd, were used for the experiment. Vaccination/Challenge Cultures [0153] Streptococcus equi strain SHMAPR was grown overnight, aerobically at 37° C., on blood agar and then inoculated in Todd Hewitt medium containing 10% foetal calf serum. The strain was then cultured for 6 hours at 37° C. in 20 ml of Todd Hewitt medium containing 10% foetal calf serum to an OD 600nm of 0.3. At this density the viable number of S. equi is 2×10 8 cfu/ml. Treatment [0154] At 4 weeks of age, 1 group of 5 mice was challenged subcutaneously (10 μl) with 1×10 6 cfu S. equi strain SHMAPR and 1 group of 5 mice was challenged subcutaneously (10 μl) with 1×10 5 cfu S. equi strain SHMAPR. [0155] After the treatments, clinical signs of disease, weight loss and mortality was recorded for 5 days. Histopathological examination of all mice was used to determine the extent of disease progression. Results: [0156] The results after subcutaneously challenge of 4 weeks old mice with 1×10 6 cfu or 1×10 5 cfu of strain SHMAPR are shown in Table 5. [0157] All mice showed signs of injection site reactions, which did not exceed the mild severity limit. The injection site reaction in one mouse challenged with 1×10 5 cfu of SHMAPR resolved by day 7 post-challenge. All mice remained active and gained weight normally during the study period ( FIG. 4 ). [0158] On post mortem examination, none of the mice had histological signs distal to the injection site. 5/5 mice challenged subcutaneously with 1×10 6 cfu and 4/5 mice challenged subcutaneously with 1×10 5 cfu S. equi SHMAPR had small injection site pustules 7 days post challenge, from which the original S. equi SHMAPR strain was isolated, highlighting that the SHMAPR strain can persist for a short time at the injection site. [0000] TABLE 5 Number Clinical Histopa- of signs of thological Group Route Dose mice Mortality disease disease SHMAPR SC 1 × 10 6 5 0 0 0 SHMAPR SC 1 × 10 5 5 0 0 0 Conclusions [0159] The S. equi SHMAPR strain was well tolerated by the subcutaneous route. All mice remained active and healthy throughout the study period. The SHMAPR strain could persist at the injection site for a short period of time, which may enhance the stimulation of the immune system. Injection site reactions in mice did not cause any clinical signs of disease and mice continued to gain weight normally during the study period. Differences in the % change in mass between the groups only became significant on day 7 and could be due to mouse/mouse variation given the small group sizes used. Therefore, the SHMAPR live attenuated vaccine also appears ideally suited for subcutaneous administration. Example 6 Intranasal and Intramuscular Safety Test of the Vaccine Strain SHMAPR in Welsh Mountain Ponies [0160] In this example, the safety and immunogenicity of the SHMAPR vaccine strain in horses by intranasal and intramuscular vaccination was determined. Animals [0161] Six male Welsh Mountain Ponies supplied by Mr. R. Beedles, Shropshire, UK were used. Ponies were approximately 8 months of age at the time of the first vaccination. Vaccination Cultures [0162] Streptococcus equi strain SHMAPR and the wild type parent 4047 strain were grown overnight, aerobically at 37° C., on blood agar and then inoculated in Todd Hewitt medium containing 10% foetal calf serum. The strains were then cultured for 6 hours at 37° C. in 20 ml of Todd Hewitt medium containing 10% foetal calf serum to an OD 600nm of 0.3. At this density the viable number of S. equi is approximately 2×10 8 cfu/ml. Treatment [0163] On day 0 the ponies received an intranasal dose of 1×10 8 cfu SHMAPR. This intranasal dose of virulent S. equi 4047 has previously been shown to induce disease in 96% of control ponies (Hamilton et al., 2006; Waller et al., 2007; Waller unpublished data). [0164] On day 14 the ponies received an intramuscular dose of 1×10 9 cfu, 1×10 8 cfu or 1×10 7 cfu SHMAPR into the right side of their neck according to Table 6: [0000] TABLE 6 Number of ponies/ID Intranasal Intramuscular Group numbers vaccine dose vaccine dose A 2/4277, 4530 1 × 10 8 cfu 1 × 10 9 cfu B 2/5066, 5251 1 × 10 8 cfu 1 × 10 8 cfu C 2/5756, 5793 1 × 10 8 cfu 1 × 10 7 cfu Results: [0165] The SHMAPR live attenuated vaccine was also found to be safe in six ponies by intranasal and intramuscular administration at doses of 1×10 8 cfu and up to 1×10 9 cfu, respectively. [0166] The intranasal vaccination phase proceeded without incident. No increase in the size of submandibular lymph nodes or signs of mucopurulent nasal discharge were observed during this two week period. [0167] Ponies were then intramuscularly vaccinated with 1×10 9 cfu, 1×10 8 cfu or 1×10 7 cfu of the SHMAPR live attenuated vaccine. No significant injection site reactions were observed in any of the vaccinated ponies and all ponies had normal neck movements and appetites, indicating that the SHMAPR vaccine can be safely administered via this vaccination route. [0168] Following post mortem examination a small pustule containing the SHMAPR live attenuated vaccine strain was found in one pony vaccinated with 1×10 8 cfu of the SHMAPR live attenuated vaccine. The pustule did not appear to be progressing beyond the injection site. This type of lesion may be highly advantageous in stimulating a prolonged protective immune response against infection with a field strain. There was no evidence for spread of the SHMAPR strain to draining lymph nodes. These data demonstrate that the SHMAPR strain resulted in a much reduced intramuscular injection site lesion compared with published data using the Intervet live attenuated strain administered by the intramuscular route (Jacobs et al., 2000). Conclusions [0169] The SHMAPR live vaccine strain is safe in ponies for administration by the intranasal and intramuscular routes. Example 7 Efficacy of the Vaccine Strain SHMAPR in Welsh Mountain Ponies [0170] In this example, the efficacy of the SHMAPR vaccine strain in horses by intramuscular vaccination was determined after challenge with virulent S. equi. Animals [0171] Eighteen Welsh Mountain Ponies were used. Ponies were approximately 14 months of age at the time of the first vaccination. Vaccination Cultures [0172] Streptococcus equi strain SHMAPR and the wild type parent 4047 strain were grown overnight, aerobically at 37 degree C., on blood agar and then inoculated in Todd Hewitt medium containing 10% foetal calf serum. The strains were then cultured for 6 hours at 37 degree C. in 20 ml of Todd Hewitt medium containing 10% foetal calf serum to an OD 600nm of 0.3. At this density the viable number of S. equi is approximately 2×10 8 cfu/ml. For vaccination, the required dose of SHMAPR was centrifuged for 10 minutes at 3000 rpm and resuspended in the appropriate volume of pre-warmed and gassed Todd Hewitt medium containing 10% foetal calf serum. Treatment [0173] On day 0 9 ponies received an intramuscular dose of 1×10 8 cfu SHMAPR in 200 μl Todd Hewitt medium containing 10% foetal calf serum. This dose of SHMAPR was previously shown to be safe over a two-week follow-up period via the intramuscular route (see example 6). The remaining 9 ponies were vaccinated with an equivalent volume of Todd Hewitt medium containing 10% foetal calf serum. [0174] Ponies were monitored for 8 weeks and then a second vaccination was administered as above. [0175] Ponies were monitored for a further 8 weeks and then challenged via administration of a dose of 1×10 8 cfu of virulent S. equi strain 4047. This dose has previously been shown to induce disease in >96% of horses. [0176] Ponies were followed for signs of disease over a three week period. All ponies were then euthanased and subjected to post mortem examination. The number of abscesses formed in the lymph nodes of ponies were noted and the amount of disease in the vaccinated vs. control populations calculated. Results: [0177] Following the first vaccination, the SHMAPR live attenuated vaccine was found to slowly induce local injection site reactions in 4 of 9 ponies vaccinated. Earliest indications occurred two to three weeks post vaccination. Lesions were generally painless and did not result in loss of appetite, but were unsightly. Drainage of lesions was performed by a veterinary surgeon following sedation of affected ponies. The lesions in all four ponies then rapidly resolved. However, lesions in two of these ponies had not fully resolved at the time of the administration of the second vaccination and these ponies were not revaccinated. Both ponies had fully recovered shortly afterwards and were included in the challenge phase of the study. [0178] Following the administration of the second vaccination to the remaining 7 ponies, slow forming injection site lesions occurred in one pony. This pony had been unaffected following the first vaccination. This lesion was drained; the pony made a full recovery and was included in the challenge phase of this study. [0179] Following challenge with virulent S. equi 8 of 9 control ponies developed pyrexia over the 3 week observation period (mean number of days pyrexic=4.0). In contrast only one vaccinated pony developed pyrexia over the same period (mean number of days pyrexic=0.1) ( FIG. 6 ). Ponies were euthanased as it became obvious that they had developed disease and before the rupture of lymph node abscesses on ethical grounds. The first control pony was euthanased 11 days post challenge and only 2 control ponies reached the endpoint of the study 18 days post challenge. All 9 vaccinated ponies reached the end of the study. [0180] On post mortem examination abscesses were found in the retropharyngeal lymph nodes of all control ponies but only 2 of the 9 vaccinated ponies. One of these 2 vaccinated ponies had only received one vaccination. The mean pathology score for controls was 33.3 (±6.3) compared with a mean of 5.0 (±4.6) for vaccinated ponies ( FIG. 7 ). Conclusions [0181] The SHMAPR live vaccine strain is efficacious for the prevention of strangles. [0000] TABLE 7A most preferred genes and homologues Bacterium Disease in animals Disease in humans sagA hasA S. equi Strangles in horses. 0 0 (beta-haemolytic) S. zooepidemicus Abortion, mastitis, keratitis, Nephritis, meningitis Currently on Currently on (beta-haemolytic) wound infections, abscesses contig contig Sequence at in a wide variety of animals. zoo32c02.p1k GZOO 1414 http://www.sanger.ac.uk/ Residues 203925- 1396- cgi-bin/blast/submitblast/ 204086 1a02.w2k1396 s_zooepidemicus incomplete residues 4614- last accessed on Jul. 01, 2008 5864 S. pyogenes None. Necrotising facititis, Residues 171838- Residues 1821324- (beta-haemolytic) pharyngitis, sepsis. 172932 1822563 Sequence at http://www.sanger.ac.uk/ Projects/S_pyogenes/ S. uberis Mastitis in cattle. NONE Residues 1676849- http://www.sanger.ac.uk/ 1678089 Projects/S_uberis/ S. pneumoniae Pneumonia in horses. Pneumonia NONE NONE http://www.sanger.ac.uk/ Projects/S_pneumoniae/23F/ S. agalactieae Mastitis in cattle Neonatal meningitis, NONE NONE NC_007432 toxic shock, skin and soft tissue infections, bacteraemia S. suis Meningitis, septicemia, Meningitis, endocarditis NONE NONE http://www.sanger.ac.uk/ arthritis, bronchopneumonia, spondylodiscitis, Projects/S_suis/ endocarditis, encephalitis, Streptococcal toxic shock abortions and abscesses in pigs. syndrome, sepsis, arthritis, endophtalmitis, pneumonia S. iniae Meningiitis, panophthalmitis Bacteraemic cellulitis Contig 00719 Contig 00200 (beta-haemolytic) in fish Subcutaneous abscess residues 19433- Residues 24289- http://www.hgsc.bcm.tmc.edu/ in dolphins 19795 25257 bcm/blast/microbialblast.cgi Last searched on Jul. 25, 2007 Bacterium SeM aroB pyrC recA S. equi 0 0 0 0 (beta-haemolytic) S. zooepidemicus Currently on Currently on Currently on Currently on (beta-haemolytic) contig contig contig contig Sequence at GZOO 1414 J25443Df01.p1k J25443Df01.p1k zoo122a01.p1k http://www.sanger.ac.uk/ 1396- Residues 384986- Residues 11359- residues 171841- cgi-bin/blast/submitblast/ 1a02.w2k1396 386020 12639 172932 s_zooepidemicus incomplete residues 29648- last accessed on Jul. 01, 2008 31387 S. pyogenes Residues 226656- Residues 582244- Residues 1097957- Residues 1756634- (beta-haemolytic) 227440 583280 1099241 1757727 Sequence at http://www.sanger.ac.uk/ Projects/S_pyogenes/ S. uberis Residues 147388- NONE Residues 995140- Residues 1764212- http://www.sanger.ac.uk/ 148092 996400 1765308 Projects/S_uberis/ S. pneumoniae NONE Residues 1312069- Residues 1048493- Residues 1901125- http://www.sanger.ac.uk/ 1312660 1049757 1902171 Projects/S_pneumoniae/23F/ S. agalactieae ref|YP_329152.1| ref|YP_330019.1| ref|YP_329756.1| ref|YP_330622.1| NC_007432 S. suis NONE NONE Residues 888290- 67730-68754 http://www.sanger.ac.uk/ 889588 Projects/S_suis/ S. iniae NONE NONE NONE contig 00203 (beta-haemolytic) residues 18147- http://www.hgsc.bcm.tmc.edu/ 19153 bcm/blast/microbialblast.cgi Last searched on Jul. 25, 2007 [0000] TABLE 7B other preferred genes and homologues Bacterium Disease in animals Disease in humans slaA seeI S. equi Strangles in horses. None 0 0 (beta-haemolytic) Also has second homologue virtually identical to the one found in zooepidemicus 5.7e−105 824084-824656 S. zooepidemicus Abortion, mastitis, keratitis, Nephritis, meningitis Contig NONE (beta-haemolytic) wound infections, abscesses zoo122a01.p1k Sequence at in a wide variety of animals. Residues 175312- http://www.sanger.ac.uk/ 175881 cgi-bin/blast/submitblast/ s_zooepidemicus S. pyogenes None. Necrotising facititis, NONE in Manfredo 6.6e−167 (beta-haemolytic) pharyngitis, sepsis. This is present in M2, M3, Residues 1031237- Sequence at M6, M28 strains and phage 1032011 http://www.sanger.ac.uk/ PhiNIH1.1at the NCBI 1e−111 Projects/S_pyogenes 29/11/07/ Bacterium seeH seeL seeM slaB S. equi 0 0 0 0 (beta-haemolytic) S. zooepidemicus NONE NONE NONE Contig (beta-haemolytic) zoo122a01.p1k Sequence at Residues 175312- http://www.sanger.ac.uk/ 175881 cgi-bin/blast/submitblast/ s_zooepidemicus S. pyogenes 1.8e−148 NONE in Manfredo NONE in Manfredo NONE in Manfredo (beta-haemolytic) Residues 204328- Present in various Present in various This is present in M2, M3, Sequence at 204943 pyogenes strains at pyogenes strains at M6, M28 strains and phage http://www.sanger.ac.uk/ NCBI 1e−131 NCBI 1e−125 PhiNIH1.1at the NCBI 4e−72 Projects/S_pyogenes 29/11/07/ [0000] TABLE 8 other preferred strains Bacterium Disease in animals Disease in humans S. canis Streptococcal toxic shock urinary infection soft (beta-haemolytic) syndrome in dogs.. Res- tissue infection, piratory infection, toxic bacteremia, pneumonia, shock, sepsis in cats bone infection S. dysgalactiae Mastitis in cattle, subsp dysgalactae S. dysgalactiae septicemia in dogs Respiratory, tissue subsp equisimilis Respiratory disease in infections, cellulitis, (beta-haemolytic) horses septicemia. S. porcinus Lymphadenitis in pigs, Abortion (beta-haemolytic) abscessation primarily of the head and neck lymph nodes, Abortion REFERENCES [0000] Alexander, J. E., Andrew, P. W., Jones, D. & Roberts, I. S. (1993) Characterization of an aromatic amino acid-dependent Listeria monocytogenes mutant: attenuation, persistence, and ability to induce protective immunity in mice. Infect Immun. 61 2245-8. Artiushin, S. C., Timoney, J. F., Sheoran, A. S., Muthupalani, S. K. (2002). Characterization and immunogenicity of pyrogenic mitogens SePE-H and SePE-I of Streptococcus equi . Microbial Pathogenesis 32 71-85. Bazeley, P. L. (1940) Experimental immunity to Str. equi . Austr. Vet. J. 16: 243-259. Bazeley, P. L. (1942) Vaccination against strangles. Austr. Vet. J. 18: 141-155. Beres, S. B., Sylva, G. L., Barbian, K. D., Lei, B., Hoff, J. S., Mammarella, N. D., Liu, M. Y., Smoot, J. C., Porcella, S. F., Parkins, L. D., Campbell, D. S., Smith, T. M., McCormick, J. K., Leung, D. Y., Schlievert, P. M., Musser, J. M. (2002). Genome sequence of a serotype M3 strain of group A Streptococcus : phage-encoded toxins, the high-virulence phenotype, and clone emergence. Proc Natl Acad Sci USA 99 10078-83. Betschel, S. D., Borgia, S. M., Barg, N. L., Low, D. E. & De Azavedo, J. C. (1998) Reduced virulence of group A streptococcal Tn916 mutants that do not produce streptolysin S. Infect Immun. 66 1671-9. Chamberlain, L. M., Strugnell, R., Dougan, G., Hormaeche, C. E. & Demarco de Hormaeche, R. (1993) Neisseria gonorrhoeae strain MS11 harbouring a mutation in gene aroA is attenuated and immunogenic. Microb Pathog. 15 51-63. Chanter, N., Ward, C. L., Talbot, N. C., Flanagan, J. A., Binns, M., Houghton, S. B., Smith, K. C. & Mumford, J. A. (1999) Recombinant hyaluronate associated protein as a protective immunogen against Streptococcus equi and Streptococcus zooepidemicus challenge in mice. Microb Pathog 27 133-43. Chanter, N., Talbot, N. C., Newton, J. R., Hewson, D. & Verheyen, K. (2000) Streptococcus equi with truncated M-proteins isolated from outwardly healthy horses. Microbiology 146 1361-9. Dougherty, B. A. & van de Rijn, I. (1994) Molecular characterization of hasA from an operon required for hyaluronic acid synthesis in group A streptococci. J Biol. Chem. 269 169-75. Galan, J. E. & Timoney, J. F. (1985) Immune complexes in purpura hemorrhagica of the horse contain IgA and M antigen of Streptococcus equi . J. Immunol. 135 3134-7. Harrington, D. J., Sutcliffe, I. C. & Chanter, N. (2002) The molecular basis of Streptococcus equi infection and disease. Microbes Infect. 4 501-10. Hamlen, H. J., Timoney, J. F., Bell, R. J. 1994. Epidemiological and immunologic characteristics of Streptococcus equi infection in foals. Journal of the American Veterinary Medical Association 204, 768-75. Hamilton A, Robinson C, Sutcliffe I C, Slater J, Maskell D J, Davis-Poynter N, Smith K, Waller A, Harrington D J. Mutation of the maturase lipoprotein attenuates the virulence of Streptococcus equi to a greater extent than does loss of general lipoprotein lipidation. Infect Immun. 2006 December; 74(12):6907-19. Hartford, O. M., Foster, T. J. & Jacobs, A. A. C. (1999) Streptococcus equi vaccine. U.S. Pat. No. 5,895,654. Appl. No.: 789727. Filed: Jan. 27, 1997. Herwald H, Cramer H, Morgelin M, Russell W, Sollenberg U, Norrby-Teglund A, Flodgaard H, Lindbom L, Bjorck L. (2004) M protein, a classical bacterial virulence determinant, forms complexes with fibrinogen that induce vascular leakage. Cell. 116:367-79. Ingham, A., Zhang, Y. & Prideaux, C. (2002) Attenuation of Actinobacillus pleuropneumoniae by inactivation of aroQ. Vet Microbiol. 84 263-73. Izhar, M., DeSilva, L., Joysey, H. S. & Hormaeche, C. E. (1990) Moderate immunodeficiency does not increase susceptibility to Salmonella typhimurium aroA live vaccines in mice. Infect Immun. 58 2258-61. Jacobs, A. A., Goovaerts, D., Nuijten, P. J., Theelen, R. P., Hartford, O. M. & Foster, T. J. (2000) Investigations towards an efficacious and safe strangles vaccine: submucosal vaccination with a live attenuated Streptococcus equi . Vet Rec 147 563-7. Jorm, L. R. (1990) Strangles in horse studs: incidence, risk factors and effect of vaccination. Aust Vet J. 67 436-9. Karnell, A., Sweiha, H. & Lindberg, A. A. (1992) Auxotrophic live oral Shigella flexneri vaccine protects monkeys against challenge with S. flexneri of different serotypes. Vaccine. 10 167-74. Kelly, C., Bugg, M., Robinson, C., Mitchell, Z., Davis-Poynter, N., Newton, J. R., Jolley, K. A., Maiden, M. C., Waller, A. S. 2006. Sequence variation of the SeM gene of Streptococcus equi allows discrimination of the source of strangles outbreaks. Journal of Clinical Microbiology 44, 480-6. Kemp-Symonds J, Kemble T, Waller A. Modified live Streptococcus equi (‘strangles’) vaccination followed by clinically adverse reactions associated with bacterial replication. Equine Vet J. 2007 May; 39(3):284-6. Kwaga, J. K., Allan, B. J., van der Hurk, J. V., Seida, H. & Potter, A. A. (1994) A carAB mutant of avian pathogenic Escherichia coli serogroup O2 is attenuated and effective as a live oral vaccine against colibacillosis in turkeys. Infect Immun. 62 3766-72. Maguin, E., Duwat, P., Hege, T., Ehrlich, D. & Gruss, A. (1992) New thermosensitive plasmid for gram-positive bacteria. J Bacteriol 174 5633-8. Meehan, M., Nowlan, P. & Owen, P. (1998) Affinity purification and characterization of a fibrinogen-binding protein complex which protects mice against lethal challenge with Streptococcus equi subsp. equi . Microbiology. 144 993-1003. Meehan, M. & Muldowney, D. A., Watkins, N. J., Owen, P. (2000) Localization and characterization of the ligand-binding domain of the fibrinogen-binding protein (FgBP) of Streptococcus equi subsp. equi . Microbiology. 146 1187-94. Meehan, M., Lynagh, Y., Woods, C. & Owen, P. (2001) The fibrinogen-binding protein (FgBP) of Streptococcus equi subsp. equi additionally binds IgG and contributes to virulence in a mouse model. Microbiology. 147 3311-22. Newland, J. W., Hale, T. L. & Formal, S. B. (1992) Genotypic and phenotypic characterization of an aroD deletion-attenuated Escherichia coli K12- Shigella flexneri hybrid vaccine expressing S. flexneri 2a somatic antigen. Vaccine. 10 766-76. Newton, J. R., Wood, J. L., Dunn, K. A., DeBrauwere, M. N. & Chanter, N. (1997) Naturally occurring persistent and asymptomatic infection of the guttural pouches of horses with Streptococcus equi. Vet Rec 140 84-90. Newton, J. R., Verheyen, K., Talbot, N. C., Timoney, J. F., Wood, J. L., Lakhani, K. H. & Chanter, N. (2000) Control of strangles outbreaks by isolation of guttural pouch carriers identified using PCR and culture of Streptococcus equi . Equine Vet J 32 515-26. Proft, T., Webb, P. D., Handley, V., Fraser, J. D. (2003). Two novel superantigens found in both group A and group C Streptococcus . Infection and Immunity 71 1361-9. Pusterla, N., Watson, J. L., Affolter, V. K., Magdesian, K. G., Wilson, W. D. & Carlson, G. P. (2003) Purpura haemorrhagica in 53 horses. Vet Rec. 153 118-21. Sheoran, A. S., Artiushin, S. & Timoney, J. F. (2002) Nasal mucosal immunogenicity for the horse of a SeM peptide of Streptococcus equi genetically coupled to cholera toxin. Vaccine 20 1653-9. Simmons, C. P., Hodgson, A. L. & Strugnell, R. A. (1997) Attenuation and vaccine potential of aroQ mutants of Corynebacterium pseudotuberculosis . Infect Immun. 65 3048-56. Stocker, B. A. (1990) Aromatic-dependent Salmonella as live vaccine presenters of foreign epitopes as inserts in flagellin. Res Microbiol. 141 787-96. Sweeney, C. R., Timoney, J. F., Newton, J. R., Hines, M. T. 2005. Streptococcus equi infections in horses: guidelines for treatment, control, and prevention of strangles. Journal of Veterinary Internal Medicine 19, 123-34. Tao, L., Hollingshead, S. K., Suvorov, A. N., Ferretti, J. J. & McShan, W. M. (1995) Construction of a Streptococcus pyogenes recA mutant via insertional inactivation, and cloning and sequencing of the complete recA gene. Gene. 162 59-62. Timoney, J. F. & Eggers, D. (1985) Serum bactericidal responses to Streptococcus equi of horses following infection or vaccination. Equine Vet J. 17 306-10. Timoney, J. F. (1993a) Strangles. Vet Clin North Am Equine Pract 9 365-374. Timoney, J. F. (1993b) Protection of equines against Streptococcus equi . U.S. Pat. No. 5,183,659 Appl. No.: 207320 Filed: Jun. 15, 1988. Timoney, J. F., Artiushin, S. C. & Boschwitz, J. S. (1997) Comparison of the sequences and functions of Streptococcus equi M-like proteins SeM and SzPSe. Infect Immun 65 3600-5. Todd, A. G. 1910. Strangles. Journal of Comparative Pathology and Therapeutics 23, 212-29. Vaughan, L. M., Smith, P. R. & Foster, T. J. (1993) An aromatic-dependent mutant of the fish pathogen Aeromonas salmonicida is attenuated in fish and is effective as a live vaccine against the salmonid disease furunculosis. Infect Immun. 61 2172-81. Walker, J. A. & Timoney, J. F. (2002) Construction of a stable non-mucoid deletion mutant of the Streptococcus equi Pinnacle vaccine strain. Vet Microbiol. 89 311-21. Waller A, Flock M, Smith K, Robinson C, Mitchell Z, Karlstrom A, Lannergard J, Bergman R, Guss B, Flock J I. Vaccination of horses against strangles using recombinant antigens from Streptococcus equi . Vaccine. 2007 May 4; 25(18):3629-35. Waller, A., Dudgeon, T., Hars, J., Johnson, I. & Czaplewski, L. G. (2001) A whole genome approach for validation of metalloenzyme targets to discover novel class antibiotics. 41 st ICAAC Poster F-2122. Wessels, M. R., Goldberg, J. B., Moses, A. E. & DiCesare, T. J. (1994) Effects on virulence of mutations in a locus essential for hyaluronic acid capsule expression in group A streptococci. Infect Immun. 62 433-41. Woolcock, J. B. (1975) Immunity to Streptococcus equi . Aust Vet J. 51 554-9. http://www.biosafety.be/EMEA/Table_EquilisStrepT.htm http://www.sangerac.uk/Projects/S_equi/ http://www.wyethah.ca/wyeth_equine/pinnacle.html Sequence Annexes 1-6 [0234] Sequence Annex 1—sagA deletion: [0000] WT ATGTTACAATTTGCTTCAAATATTTTAGCTACTAGTGTAGCAGAAACAACTCAAGTTGCTCCTGGTGGTTGCTGCTGTTG SHMAPR ATGTTACAATTTGCT----------------------------------------------------------------- WT CTGTTCTTGTTGTTGCTGCGTCTCAGCTTCATGGGGCAATACTACCATAAACAACAATTATGGTGCAGCTGAGCCAAAAG SHMAPR ------------------------------------------------------------- AAGCTT GCTGAGCCAAAAG WT CGTAA SHMAPR CGTAA The HindIII restriction site used to generate the deletion construct is shown in italics. Sequence Annex 2—hasA deletion: [0000] WT ATGAGAACATTAAAAAACCTCATAACTGTTGTGGCCTTTAGTATTTTTTGGGTACTGTTGATTTACGTCAATGTTTATCT SHMAPR ATGAGAACATTAAAAAACCTCATAACTGTTGTGGCCTTTAGTATTTTTTGGGTACTGTTGATTTACGTCAATGTTTATCT WT CTTTGGTGCTAAAGGAAGCTTGTCAATTTATGGCTTTTTGCTGATAGCTTATCTATTAGTCAAAATGTCCTTATCTTTTT SHMAPR CTTTGGTGCTAAAGGAAGCTTGTCAATTTATGGCTTTTTGCTGATAGCTTATCTATTAGTCAAAATGTCCTTATCTTTTT WT TTTACAAGCCATTTAAGGGAAGGGCTGGGCAATATAAGGTTGCAGCCATTATTCCCTCTTATAACGAAGACGCTGAGTCA SHMAPR TTTACAAGCCATTTAAGGGAAGGGCTGGGCAATATAAGGTTGCAGCCATTATTCCCTCTTATAACGAAGACGCTGAGTCA WT TTGCTAGAGACCTTAAAAAGTGTTCAGCAGCAAACCTATCCCCTAGCAGAAATTTATGTTGTTGACGATGGAAGTGCTGA SHMAPR TTGCTAGAGACCTTAAAAAGTGTTCAGCAGCAAACCTATCCCCTAGCAGAAAT--------------------------- WT TGAGACAGGTATTAAGCGCATTGAAGACTATGTGCGTGACACTGGTGACCTATCAAGCAATGTCATTGTTCATCGGTCAG SHMAPR -------------------------------------------------------------------------------- WT AGAAAAATCAAGGAAAGCGTCATGCACAGGCCTGGGCCTTTGAAAGATCAGACGCTGATGTCTTTTTGACCGTTGACTCA SHMAPR -------------------------------------------------------------------------------- WT GATACTTATATCTACCCTGATGCTTTAGAGGAGCTGTTAAAGACCTTTAATGACCCAACTGTTTTTGCTGCGACGGGTCA SHMAPR -------------------------------------------------------------------------------- WT CCTTAATGTCAGAAATAGACAAACCAATCTCTTAACACGCTTGACAGATATTCGCTATGATAATGCTTTTGGCGTTGAAC SHMAPR -------------------------------------------------------------------------------- WT GAGCTGCCCAATCAGTTACGGGTAATATCCTTGTTTGCTCAGGCCCACTTAGCGTTTACAGACGCGAGGTGGTTGTTCCT SHMAPR -------------------------------------------------------------------------------- WT AATATAGACAGATACATCAACCAGACCTTCCTGGGTATTCCTGTAAGTATCGGTGATGACAGGTGCTTGACCAACTATGC SHMAPR -------------------------------------------------------------------------------- WT AACTGATTTAGGAAAGACTGTTTATCAATCCACTGCTAAATGTATTACAGATGTTCCTGACAAGATGTCTACTTACTTGA SHMAPR -------------------------------------------------------------------------------- WT AGCAGCAAAACCGCTGGAACAAGTCCTTCTTTAGAGAGTCCATTATTTCTGTTAAGAAAATCATGAACAATCCTTTTGTA SHMAPR -------- GATATC TGGAACAAGTCCTTCTTTAGAGAGTCCATTATTTCTGTTAAGAAAATCATGAACAATCCTTTTGTA WT GCCCTATGGACCATACTTGAGGTGTCTATGTTTATGATGCTTGTTTATTCTGTGGTGGATTTCTTTGTAGGCAATGTCAG SHMAPR GCCCTATGGACCATACTTGAGGTGTCTATGTTTATGATGCTTGTTTATTCTGTGGTGGATTTCTTTGTAGGCAATGTCAG WT AGAATTTGATTGGCT CAGGGTTTTAGCCTTTCTGGTGATTATCTTCATTGTTGCTCTTTGTCGGAACATTCATTACATGC SHMAPR AGAATTTGATTGGCTCAGGGTTTTAGCCTTTCTGGTGATTATCTTCATTGTTGCTCTTTGTCGGAACATTCATTACATGC WT TTAAGCACCCGCTGTCCTTCTTGTTATCTCCGTTTTATGGGGTGCTGCATTTGTTTGTCCTACAGCCCTTGAAATTGTAT SHMAPR TTAAGCACCCGCTGTCCTTCTTGTTATCTCCGTTTTATGGGGTGCTGCATTTGTTTGTCCTACAGCCCTTGAAATTGTAT WT TCTCTTTTTACTATTAGAAATGCTGACTGGGGAACACGTAAAAAATTATTATAA SHMAPR TCTCTTTTTACTATTAGAAATGCTGACTGGGGAACACGTAAAAAATTATTATAA The EcoRV restriction site used to generate the deletion construct is shown in italics. Sequence Annex 3—seM deletion: [0000] WT ATGTTTTTGAGAAATAACAAGCAAAAATTTAGCATCAGAAAACTAAGTGCCGGTGCAGCATCAGTATTAGTTGCAACAAG SHMAPR ATGTTTTTGAGAAATAACAAGCAAAAATTTAGCATCAGAAAACTAAGTGCCGGTGCAGCATCAGTATTAGTTGCAACAAG WT TGTGTTGGGAGGGACAACTGTAAAAGCGAACTCTGAGGTTAGTCGTACGGCGACTCCAAGATTATCGCGTGATTTAAAAA SHMAPR TGTGTTGGGAGGGACAACTGTAAAAGCGAACTCTGAGGTTAGTCGTACGGCGACTCCAAGATTATCGCGTGATTTAAAAA WT ATAGATTAAGCGAAATAGCCATAAGTAGAGATGCCTCATCAGCCCAAAAAGTTCGAAATCTTCTAAAAGGCGCCTCTGTT SHMAPR ATAGATTAAGCGAAATAGCCATAAGTAGAGATGCCTCATCAGCCCAAAAAGTTCGAAATCTTCTAAAAGGCGCCTCTGTT WT GGGGATTTACAGGCATTATTGAGAGGTCTTGATTCAGCAAGGGCTGCGTATGGTAGAGATGATTATTACAATTTATTGGT SHMAPR GGGGATTTACAGGCATTATTGAGAGGTCTTGATTCAGCAAGGGCTGCGTATGGTAGAGATGATTATTACAATTTATTGGT WT GCACCTTTCATCGATGTTAAATGATAAACCTGATGGGGATAGAAGACAATTAAGTTTGGCTTCATTACTTGTAGATGAAA SHMAPR GCACCTTCCATCGATG TAA AAT GATATC ---------------------------------------------------- WT TTGAAAAGCGGATTGCTGATGGAGATAGTTATGCAAAACTTCTTGAGGCTAAACTTGCAGCTATTAAATCTCAACAAGAA SHMAPR -------------------------------------------------------------------------------- WT ATGCTTAGAGAAAGAGATTCCCAACTTCGAAATCTAGAGAAGGAAAAAGAACAAGAACTACAAAAAGCTAAAGATGAGCG SHMAPR -------------------------------------------------------------------------------- WT TCAAGCTCTTACCGAATCATTCAACAAAACTTTATCAAGATCAACAAAAGAGTATAATAAACTAAAAACAGAACTTGCAA SHMAPR -------------------------------------------------------------------------------- WT AAGAAAAAGAAAAAGCAGCTAAGATGACTAAGGAATTAGCAGATAAGCTAAGCAATGCTGAAGCAAGTCGTGATAAAGCC SHMAPR -------------------------------------------------------------------------------- WT TTTGCAGTATCAAAAGATTTAGCAGATAAACTAAGTAGTGCTGAAGCAAGTCGTGATAAAGCTTTTGCAGTATCAAAAGA SHMAPR -------------------------------------------------------------------------------- WT TTTAGCAGATAAATTGGCAGCTAAAACAGCAGAAGCTGAAAAGTTAATGGAAAACGTTGGTAGTCTAGACCGCTTGGTAG SHMAPR -------------------------------------------------------------------------------- WT AGTCTGCAAAACGTGAAATGGCTCAAAAATTAGCAGAAATTGATCAATTAACTGCTGATAAGGCTAAGGCTGATGCAGAG SHMAPR -------------------------------------------------------------------------------- WT CTTGCAGCTGCAAATGACACCATTGCATCACTTCAAACAGAGCTAGAAAAAGCTAAGACAGAGCTTGCTGTTTCAGAGCG SHMAPR -------------------------------------------------------------------------------- WT TTTGATTGAATCAGGCAAACGTGAAATTGCTGAGCTACAAAAACAAAAAGATGCTTCTGATAAGGCTTTAGTAGAATCAC SHMAPR -------------------------------------------------------------------------------- WT AAGCTAATGTAGCAGAGCTTGAAAAACAAAAAGCAGCATCAGATGCTAAGGTAGCAGAGCTTGAAAAAGAAGTTGAAGCT SHMAPR -------------------------------------- TGA GATGCTAAGGTAGCAGAGCTTGAAAAAGAAGTTGAAGCT WT GCTAAAGCTGAGGTTGCAGATCTTAAAGTACAATTAGCTAAGAAAGAAGAAGAGCTTGAAGCCGTTAAGAAGGAAAAAGA SHMAPR GCTAAAGCTGAGGTTGCAGATCTTAAAGTACAATTAGCTAAGAAAGAAGAAGAGCTTGAAGCCGTTAAGAAGGAAAAAGA WT AGCGCTTGAAGCTAAGATTGAAGAGCTCAAAAAAGCTCATGCTGAGGAACTTTCAAAACTTAAAGAAATGCTTGAGAAGA SHMAPR AGCGCTTGAAGCTAAGATTGAAGAGCTCAAAAAAGCTCATGCTGAGGAACTTTCAAAACTTAAAGAAATGCTTGAGAAGA WT AAGACCATGCAAATGCAGATCTTCAAGCAGAAATCAATCGCTTGAAGCAAGAGCTAGCTGACAGGATTAAGTCATTGTCA SHMAPR AAGACCATGCAAATGCAGATCTTCAAGCAGAAATCAATCGCTTGAAGCAAGAGCTAGCTGACAGGATTAAGTCATTGTCA WT CAAGGTGGTCGTGCTTCACAAACAAACCCAGGCACTACAACTGCTAAAGCAGGTCAATTGCCATCTACTGGTGAGTCTGC SHMAPR CAAGGTGGTCGTGCTTCACAAACAAACCCAGGCACTACAACTGCTAAAGCAGGTCAATTGCCATCTACTGGTGAGTCTGC WT TAACCCATTCTTCACTATTGCAGCTCTTACTGTCATCGCTGGTGCTGGTATGGCTGTGGTGTCTCCTAAACGCAAAGAAA SHMAPR TAACCCATTCTTCACTATTGCAGCTCTTACTGTCATCGCTGGTGCTGGTATGGCTGTGGTGTCTCCTAAACGCAAAGAAA WT ACTAA SHMAPR ACTAA The seM deletion generated two stop codons (underlined), which would abolish cell surface binding of the truncated SeM product. The EcoRV restriction site used to generate the deletion construct is shown in italics. Sequence Annex 4—aroA deletion: [0000] WT ATGACACAAACACTTCAGGTTAAGTCTCGTATCAATGACTATCCGATTATCTTTACAGACGATATTTTTCAGCCGCTGAA SHMAPR ATGACACAAACACTTCAGGTTAAGTCTCGTATCAATGACTATCC------------------------------------ WT TCAATTTCTTGCTGAAAAAGGAGACGTCAAGCTATTATTTATCACTGATCAAACGGTATTTGATTTATACCAGCCTTTAT SHMAPR -------------------------------------------------------------------------------- WT TTAGACGTTTTCAACAGGATTACGATAGTTACCTTCATATTGCTGCTCCAGGGGGGCAATCTAAGTCTCTAGAGGAGGTT SHMAPR -------------------------------------------------------------------------------- WT AGTCGGATTTACGATCGACTGATTAGGGCTAATTTTTCTAAAAAGGACGTCATTGTTACTGTTGGAGGAGGGGTGATTGG SHMAPR WT AGATCTTGGGGGATTTGTTGCGGCAACCTTTTACCGCGGGATTTCCTACGTTCAGATTCCAACAACCTTACTTAGTCAGG SHMAPR -------------------------------------------------------------------------------- WT TAGACAGCAGCATTGGTGGTAAGGTTGGGGTTCACTTTAAGGGCTTGACCAATATGATAGGCAGTATCTACCCTCCAAAC SHMAPR -------------------------------------------------------------------------------- WT CAGATTATCGTGTCAGCCAAGTTTTTAGACACGCTTTCTGAAAGAGAATTTGCCTGCGGCATCAGCGAAATGATTAAAAT SHMAPR -------------------------------------------------------------------------------- WT TGGTTTTATTCATGATCGCAAGCTCTTTCAACAGCTCCTAGCCTTCCCCAAGGACCGCAATCAAGAGCAGCTCAGGCAAA SHMAPR -------------------------------------------------------------------------------- WT TGATTTTTCAAGCGATTTGCCATAAAAAAAGAGTGGTTGAAAAGGATGAATTTGAAGGCAATCTCCGCATGTCCTTAAAT SHMAPR -------------------------------------------------------------------------------- WT TTCGGGCATACGCTAGGGCATGCGATTGAAGCCTTATGCCATCACGAGCTTTACAGGCATGGTGAGGCTATTGCGATTGG SHMAPR -------------------------------------------------------------------------------- WT CATGGTCTTTGAGGCCAAGCTGGCCGTCCAGCAGCAGCTATTGAGCCAACAGGATTTAGAGGCATTACAGGCTGCCTTTG SHMAPR -------------------------------------------------------------------------------- WT AGGCTTATCAGCTACCTACCACACTTGAGGCTAAGTCAATGACAGCCGAAGCCTTGATGACTGTTTTAAAAACAGATAAG SHMAPR -------------------------------------------------------------------------------- WT AAAAATTCTGGTCAGCATATTGTCCTCATTTTGCCAACGACAAAAGGCTATGTAAGCTTTCCTATTGCTAAGCATGACAG SHMAPR -------------------------------------------------------------------------------- WT TCGCCTGCTGGATTGGCTAAGAA GCCTGCTAGATATCGCCTGA SHMAPR ------------------------------- GATATC GCCTGA The EcoRV restriction site used to generate the deletion construct is shown in italics. Sequence Annex 5—pyrC deletion: [0000] WT ATGATATCAGGGATCAAGACAGTTACGTCCGATATGTCAAGCAAAACAAATAATCACTGCCTAGATAAATCAGAAATTGC SHMAPR ATGATATCAGGGATCAAGACAGTTACGTCCGATATGTCAAGCAAAACAAATAATCACTGCCTAGATAAATCAGAAATTGC WT TAGGGTTATGCTTGATTATCCTGATAAGCAGATAAGTAGATTTGACATAGGAGGGGTCATGTTATTAATTAAAAATGGGC SHMAPR TAGGGTTATGCTTGATTATCCTGATAAGCAGATAAGTAGATTTGACATAGGAGGGGTCATGTTATTAATTAAAAATGGGC WT GTGTGATGGATCCAAAATCACAGCTAGATCAGGTGGCAGATGTCTTAATTGATAATGGAAGGATTTTACGGATTGCTCCA SHMAPR GTGTGATGGATCCAAAATCACAGCTAGATCAGGTGGC AAGCTT ------------------------------------- WT GACATTGAGCATGATGAGGTAGAGCAGATCGATGCCAGTGGACTTGTTGTTGCTCCTGGTTTAGTGGATATTCATGTTCA SHMAPR -------------------------------------------------------------------------------- WT TTTTAGAGAGCCGGGTCAAACGCACAAGGAGGACATTCATACAGGTGCTCTGGCAGCAGCTGCTGGTGGGGTGACAACAG SHMAPR -------------------------------------------------------------------------------- WT TAGTCATGATGGCAAACACCAATCCTGTTATATCAGATACGGAAACCTTACAGGCTGTTCTAGCAAGTGCTGCTAAAGAA SHMAPR -------------------------------------------------------------------------------- WT AAAATTAACATTTATACCAATGCTAGTGTGACCAAGCGGTTCAATGGCCAAGAGCTAACAGACTTTAAAGCGCTCTTAGC SHMAPR -------------------------------------------------------------------------------- WT AGCTGGTGCGGTCAGTTTTTCTGATGATGGCATTCCTTTAGAGAGCTCCAAGGTCTTAAAGGAAGCATTGGATTTGGCTA SHMAPR -------------------------------------------------------------------------------- WT AGGCCAACAAGACCTTCATTGCCCTGCATGAGGAGGATCCCCAATTAAACGGTGTCCTTGGCTTCAATGAGCATATCGCT SHMAPR -------------------------------------------------------------------------------- WT AAGGATCATTTTCATTTTTGTGGCGCTACTGGTGTGGCAGAATATAGTATGATTGCCAGAGATGTGATGATTGCCTATGA SHMAPR -------------------------------------------------------------------------------- WT TCGACAAGCTCATGTTCATATTCAACATTTATCTAAGGCTGAGTCTGTTAAGGTAGTTGCCTTTGCTCAGCAGTTAGGTG SHMAPR -------------------------------------------------------------------------------- WT CCAAGGTCACAGCCGAGGCAACACCGCAGCATTTTTCTAAAACAGAAGACCTTTTACGGCTTGCAGGGGCAAATGCCAAG SHMAPR -------------------------------------------------------------------------------- WT ATGAATCCGCCTCTAAGAACAGAACAAGATAGATTAGCAGTTATTGAGGGGCTCAAATCAGGTGTCATAGCTATTATTGC SHMAPR -------------------------------------------------------------------------------- WT AACGGATCATGCACCACATCATCGTGATGAAAAGGCCGTTGCTGATCTGACCAAGGCACCATCTGGAATGACCGGCTTAG SHMAPR -------------------------------------------------------------------------------- WT AAACCTCATTGTCATTAGGCCTGACAAATCTTGTGGAGCCGAGCCATCTTTCATTGATGGCGTTATTAGAGAAAATGACC SHMAPR -------------------------------------------------------------------------------- WT ATTAATCCAGCCTCACTATATAGCTTTGATGCTGGTTATTTGGCTGAGTCTGGCCCTGCTGATCTTGTTATTTTTGCTGA SHMAPR -------------------------------------------------------------------------------- WT CAAGGAGGAGCGTTTGGTAACAGAAGCCTTTGCTTCAAAGGCTAGTAATTCACCTTTTATTGGCGAAACCCTAAAGGGAG SHMAPR --------AGCGTTTGGTAACAGAAGCCTTTGCTTCAAAGGCTAGTAATTCACCTTTTATTGGCGAAACCCTAAAGGGAG WT TTGTGAAATACACCATTGCTAAGGGACAAATTGTTTATCAGGCAGACAACTAA SHMAPR TTGTGAAATACACCATTGCTAAGGGACAAATTGTTTATCAGGCAGACAACTAA The HindIII restriction site used to generate the deletion construct is shown in italics. Sequence Annex 6—recA deletion: [0000] WT TTGGCAAAAAAAGTTAAAAAAAATGAAGAAATCACCAAAAAATTTGGTGATGAACGTCGTAAAGCACTTGATGATGCGTT SHMAPR TTGGCAAAAAAAGTTAAAAAAAATGAAGAAATCACCAAAAAATTTGGTGATGAACGTCGTAAAGCACTTGATGATGCGTT WT AAAGAACATCGAAAAAGATTTTGGTAAGGGTGCGGTTATGCGCCTTGGTGAGCGTGCAGAGCAAAAGGTTCAGGTGATGA SHMAPR AAAGAACATCGAAAAAGATTTTGGTAAGGGTGCGGTTATGCGCCTTGGTGAGCGTGCAGAGCAAAAGGTTCAGGTGATGA WT GTTCAGGCAGTCTTGCTTTAGACATTGCGCTTGGAGCAGGTGGCTATCCTAAAGGGCGTATTATTGAAATCTATGGACCA SHMAPR GTTCAGGCAGTCTTGCTTTAGACATTGCGCTTGGAGCAGGTGGCTATCCTAAAGGGCGTATTATTGAAATCTATGGACCA WT GAGTCTTCTGGTAAAACAACAGTTGCCCTGCATGCAGTAGCGCAGGCTCAAAAAGAAGGTGGTATTGCAGCCTTCATTGA SHMAPR GAGTCTTCTGGTAAAACAACAGTTGCCCTGCATGCAGTAGCGCAGGCTCAAAAAGAAGGTGGTATTGCAGCCTT------ WT TGCGGAGCATGCCTTGGACCCTGCTTATGCTGCGGCGCTGGGTGTTAATATTGATGAGCTGCTTTTGTCACAGCCGGATT SHMAPR -------------------------------------------------------------------------------- WT CTGGTGAGCAAGGACTTGAGATAGCAGGTAAACTGATTGATTCTGGTGCTGTTGATTTGGTTGTTGTCGACTCTGTTGCA SHMAPR -------------------------------------------------------------------------------- WT GCTCTAGTGCCTCGTGCTGAGATTGATGGTGATATTGGTGATAACCATGTTGGCTTGCAGGCTCGTATGATGAGTCAGGC SHMAPR -------------------------------------------------------------------------------- WT GATGCGTAAGCTTTCAGCCTCAATCAATAAAACCAAGACAATTGCGATCTTTATTAACCAGCTGCGTGAAAAGGTAGGGG SHMAPR -------------------------------------------------------------------------------- WT TTATGTTTGGTAATCCAGAGACGACACCAGGTGGTCGTGCTTTGAAATTCTATGCCTCTGTCCGTCTGGATGTTCGTGGA SHMAPR -------------------------------------------------------------------------------- WT ACAACACAAATAAAAGGAACTGGAGATCAAAAAGACAGTAGTATTGGTAAGGAAACCAAGATTAAGGTTGTTAAGAATAA SHMAPR -------------------------------------------------------------------------------- WT GGTTGCTCCGCCATTTAAGGTGGCTGAGGTTGAAATCATGTATGGAGAAGGCATCTCACGTACAGGTGAGCTGATTAAAA SHMAPR ---------------------------------------- GATATC GAAGGCATCTCACGTACAGGTGAGCTGATTAAAA WT TTGCTTCAGATTTAGACATTATTCAAAAGGCTGGTGCTTGGTTCTCTTATAACGGTGAAAAAATTGGTCAGGGCTCTGAA SHMAPR TTGCTTCAGATTTAGACATTATTCAAAAGGCTGGTGCTTGGTTCTCTTATAACGGTGAAAAAATTGGTCAGGGCTCTGAA WT AATGCCAAGAGATATTTGGCTGATCACCCAGAGCTGTTTGATGAGATTGACCATAAGGTGCGTGTTAAATTTGGCTTGCT SHMAPR AATGCCAAGAGATATTTGGCTGATCACCCAGAGCTGTTTGATGAGATTGACCATAAGGTGCGTGTTAAATTTGGCTTGCT WT TGAAGATACTGAGGAAAGTGCAGCTGCAGATACAGTTGCAGCCAAAGCAGATGAGTTGGTTTTAGAGCTAGACGATGCCA SHMAPR TGAAGATACTGAGGAAAGTGCAGCTGCAGATACAGTTGCAGCCAAAGCAGATGAGTTGGTTTTAGAGCTAGACGATGCCA WT TTGAAATTGAGGATTAG SHMAPR TTGAAATTGAGGATTAG The EcoRV restriction site used to generate the deletion construct is shown in italics.

Description

Topics

Download Full PDF Version (Non-Commercial Use)

Patent Citations (1)

    Publication numberPublication dateAssigneeTitle
    US-2006110411-A1May 25, 2006Wyeth - Fort Dodge LaboratoriesStreptococcus equi vaccine compositions and method of use

NO-Patent Citations (0)

    Title

Cited By (0)

    Publication numberPublication dateAssigneeTitle